PNSNP A database of Nicotinan SNPs

 

Welcome to Nicotinan SNPs Database

Verification


 


The principle of our Verification


Primer information


Primer name Forward Primer Reverse Primer Product Size Forward Start Reverse Start Forward Length Reverse Length Forward Tm Reverse Tm Forward GC Reverse GC
CK281441-101-600 CCAAAGCCATCTCCTCACTC ACTCCATTGCATTCCCAAAC 402 111 493 20 20 59.8 59.8 55.00 45.00
GO604297-201-700 ACAACTGGCTGCTGAGCTTC TCTCCAACACAAGGAGAGCA 401 296 650 20 20 60.74 59.54 55.00 50.00

 


Sequences

An clustal analysis of the sequence data.

Download the sequence


Evolution analysis


The phylogenetic tree of the 15 Nicotiana varieties

Copyright©2014 : Tobacco Laboratory,Shandong Agricultural University PostCode: 271018